SGN Marker solcap_snp_sl_40679

SGN-M23093

Synonyms  
CL016059-0375
CL016059-0375_solcap_snp_sl_40679
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59424)
Chromosome
8
Position
23.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTAAAAAGTCATTACTCTGCATTTTCTTCTCAGCCAGCTCTTTAGCCCT
  
3' flanking region
AGGGCTTCATCCTTGTTGCACTCCATCACAATCCCAATAAAGATATTAAT
SNP nucleotide
TG
SNPdb format
CCTAAAAAGTCATTACTCTGCATTTTCTTCTCAGCCAGCTCTTTAGCCCT[T/G]
AGGGCTTCATCCTTGTTGCACTCCATCACAATCCCAATAAAGATATTAAT
  
Genomic location of solcap_snp_sl_40679  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23093 marker 23093
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)