Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_41115

SGN-M23161

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68822)
Chromosome
12
Position
31.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59492)
Chromosome
12
Position
2.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAGGAAATGCTTTCAATTTTCCATTAAGTCCGTCGTCTCAGAGCTCTC
  
3' flanking region
TCTTTGGCCTTCTTCTTTTGTGAGGCATCAGTGCGTCAAAAATTTCCACA
SNP nucleotide
TC
SNPdb format
AAAAGGAAATGCTTTCAATTTTCCATTAAGTCCGTCGTCTCAGAGCTCTC[T/C]
TCTTTGGCCTTCTTCTTTTGTGAGGCATCAGTGCGTCAAAAATTTCCACA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_41115  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23161 marker 23161
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)