SGN Marker CT187

SGN-M232

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
ATCATTCTTCCGCAGCACTCGCGGCACCTAGGTCCACATTGAGGTCAAGAACCTTTCCAGTTATTTTTGTGTACAAATTGAGCACATCAT
CTACAGTCGACTCAAAGTGAGTTGTTGCATCATAGCTAGTTGAAACAAAACAATTGTCCAAGGTGCACTCATTGACAGGTTCAGATCGGT
CATAAGTTTCATAGACGATCTCATCCACTGGCCCTAGAAGACTGACGCCTGTCTTCAGTTCATTCTCTGGGTTATCAGTTTCTGCCTCTG
TTGAGACAAATGCAATGAATTTCCCCTTTGGAGCAACATTATGAGTGTAAGAACAGCAGAACAGGTACATATCTGATTTGCGACCCAACT
GCTTCTGAGGTAGGATAATCTGCACAGAGTGAGATTCGCTGGTATTTGGAATTGGGTGGCTCAT
Reverse sequence
TTTTTTTTTTTTTTGTTTGGTTCTTCAAGTTGATTGTGGAAGTAAAGCTAAGGAAAGAGCTAGAGAAATTCTCAAATTTCATGCAAAGGC
ATGGAGGCTCTTAAATCTCCTCTGATGGGCATTTTTGAGAAGCGACGTGCTCGAAAGTTTTTTATTTATGTTCAAGATTATAAAGAAAGT
GATCCTAAAACGCATGAAGGGATGGATCTAACAAAAGTTACCACAAGAGAGCTTATTGCAAAATATGGTCTTGATGACAACACTGTTGAC
TTCATTGGTCATGCATTGGCACTGCATAGGGATGATCGCTACCTAGATGAACCAGCACTGGATACTGTGAAGAGAATGAAGCTATATGCT
GAGTCTCTTGCTCGTTTCCAAGGAGGATCACCATATATTTATCCTTTGTATGGATTAGGAGAGCTCCCCCAGGCATTTGCTCGATTGAGT
GCTGTCTATGGTGGGAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1444632.3e-95423 (99.8% of RFLP seq)+
SGN-U144464424 (100.0% of RFLP seq)+
SGN-U1611841.5e-1675 (16.1% of RFLP seq)-
SGN-U1611834e-2061 (13.1% of RFLP seq)-
SGN-U1446122e-4083 (17.8% of RFLP seq)-
SGN-U1444631e-103377 (80.7% of RFLP seq)-
SGN-U144464378 (80.9% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42313)
Chromosome
8
Position
34.80 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 8694)
Chromosome
8
Position
16.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8692)
Chromosome
8
Position
12.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8693)
Chromosome
12
Position
42.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT187 was used as an overgo probe on plate 6 [well H5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P162G15,   P136L22,   P074J17,   P134L22,   P127H20,   P243O21,   P017G09,   P316B17,   P319C09,   P304D20,   P178A15,   P300M03,   P160I11,   P257M08,   P276D03,   P330H09

 Overgo Sequences

A sequence
GCACAGAGTGAGATTCGCTGGTAT
B sequence
AGCCACCCAATTCCAAATACCAGC
AB sequence
GCACAGAGTGAGATTCGCTGGTATTTGGAA
Marker sequence
ATCATTCTTCCGCAGCACTCGCGGCACCTAGGTCCACATTGAGGTCAAGA
ACCTTTCCAGTTATTTTTGTGTACAAATTGAGCACATCATCTACAGTCGA
CTCAAAGTGAGTTGTTGCATCATAGCTAGTTGAAACAAAACAATTGTCCA
AGGTGCACTCATTGACAGGTTCAGATCGGTCATAAGTTTCATAGACGATC
TCATCCACTGGCCCTAGAAGACTGACGCCTGTCTTCAGTTCATTCTCTGG
GTTATCAGTTTCTGCCTCTGTTGAGACAAATGCAATGAATTTCCCCTTTG
GAGCAACATTATGAGTGTAAGAACAGCAGAACAGGTACATATCTGATTTG
CGACCCAACTGCTTCTGAGGTAGGATAATCTGCACAGAGTGAGATTCGCT
GGTATTTGGAATTGGGTGGCTCAT
Genomic location of CT187  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D232 marker 232
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)