Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_41500

SGN-M23233

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59564)
Chromosome
12
Position
55.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAATACGACTTTGACAAACCATTGGCAACCTAAATTTTTTACCTTCTTTG
  
3' flanking region
AATTGCAAGTGCTATGAGTTCTGCTATACCAGTTCCAGCCTGTGATCACG
SNP nucleotide
AG
SNPdb format
GAATACGACTTTGACAAACCATTGGCAACCTAAATTTTTTACCTTCTTTG[A/G]
AATTGCAAGTGCTATGAGTTCTGCTATACCAGTTCCAGCCTGTGATCACG
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_41500  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23233 marker 23233
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)