SGN Marker solcap_snp_sl_41866

SGN-M23271

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65238)
Chromosome
6
Position
46.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59602)
Chromosome
6
Position
36.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCAGTACTCCACAACTGTGGACTTAAAATTGTGATCCGCCTCGGCAAAG
  
3' flanking region
AGATTAAAGCCTATTATCAAAGCACTTCCACAACCTATTGTACCATTAAT
SNP nucleotide
AT
SNPdb format
TCCAGTACTCCACAACTGTGGACTTAAAATTGTGATCCGCCTCGGCAAAG[A/T]
AGATTAAAGCCTATTATCAAAGCACTTCCACAACCTATTGTACCATTAAT
  
Genomic location of solcap_snp_sl_41866  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23271 marker 23271
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)