SGN Marker solcap_snp_sl_41917

SGN-M23276

Synonyms  
SGN-U581407_snp1428
SGN-U581407_snp1428_solcap_snp_sl_41917
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63470)
Chromosome
6
Position
44.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59607)
Chromosome
6
Position
37.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACCATTGCAAGGAAGTTGGTGTAAAAGCTACCTTGAACATCATCAACTT
  
3' flanking region
CCATACATGTAATCAACAATAAGCAGGGTACGATTAAGAGTGTGTTAAAT
SNP nucleotide
AG
SNPdb format
AACCATTGCAAGGAAGTTGGTGTAAAAGCTACCTTGAACATCATCAACTT[A/G]
CCATACATGTAATCAACAATAAGCAGGGTACGATTAAGAGTGTGTTAAAT
  
Genomic location of solcap_snp_sl_41917  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23276 marker 23276
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)