SGN Marker solcap_snp_sl_42155

SGN-M23288

Synonyms  
SGN-U578180_snp622
SGN-U578180_snp622_solcap_snp_sl_42155
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59619)
Chromosome
6
Position
38.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACTGTGTATCCTAGGAAGAATTGGTCATCCATGGTTCTTTATAATTGTG
  
3' flanking region
GCATCCAAAGAATAAGGTCTTGACACCTGAGATTGTCAATACTGAAACTG
SNP nucleotide
CG
SNPdb format
AACTGTGTATCCTAGGAAGAATTGGTCATCCATGGTTCTTTATAATTGTG[C/G]
GCATCCAAAGAATAAGGTCTTGACACCTGAGATTGTCAATACTGAAACTG
  
Genomic location of solcap_snp_sl_42155  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23288 marker 23288
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)