SGN Marker solcap_snp_sl_42324

SGN-M23297

Synonyms  
SGN-U579752_snp292
SGN-U579752_snp292_solcap_snp_sl_42324
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70450)
Chromosome
2
Position
61.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66981)
Chromosome
2
Position
80.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63457)
Chromosome
2
Position
111.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59628)
Chromosome
2
Position
44.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATAAGGTCATCGGTTCACTGCCTGTTTTTGGTCTCATAGCCAGAATTGT
  
3' flanking region
AATGAGGAAGGTGGTGTTGGAGGCGATTTTATTGATTTTGCGGAGTTCAG
SNP nucleotide
TC
SNPdb format
AATAAGGTCATCGGTTCACTGCCTGTTTTTGGTCTCATAGCCAGAATTGT[T/C]
AATGAGGAAGGTGGTGTTGGAGGCGATTTTATTGATTTTGCGGAGTTCAG
  
Genomic location of solcap_snp_sl_42324  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23297 marker 23297
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)