SGN Marker solcap_snp_sl_42453

SGN-M23303

Synonyms  
SGN-U318040_U146494_snp347
SGN-U318040_U146494_snp347_solcap_snp_sl_42453
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66893)
Chromosome
2
Position
79.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63378)
Chromosome
2
Position
109.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59634)
Chromosome
2
Position
43.53 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGAAGTTGTTGACTACTCCCATGGGAAACAGCTGTGGGAGCTATGTAA
  
3' flanking region
GAAAAATATGAACCTTTGTGGATAAATGGAGGTGGACACTGCAATCTTGA
SNP nucleotide
AC
SNPdb format
GATGAAGTTGTTGACTACTCCCATGGGAAACAGCTGTGGGAGCTATGTAA[A/C]
GAAAAATATGAACCTTTGTGGATAAATGGAGGTGGACACTGCAATCTTGA
  
Genomic location of solcap_snp_sl_42453  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23303 marker 23303
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)