SGN Marker solcap_snp_sl_42471

SGN-M23307

Synonyms  
SGN-U316347_T1535_snp219
SGN-U316347_T1535_snp219_solcap_snp_sl_42471
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70358)
Chromosome
2
Position
57.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59638)
Chromosome
2
Position
43.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATCTTCTTGTTGAAAAACACATTTAAATGCCTTATCATCAGCACCTTT
  
3' flanking region
TGGGTTCTCACCACATGCATTAATCTGTATTTAGCTCTTGCACTATCTTT
SNP nucleotide
AG
SNPdb format
GGATCTTCTTGTTGAAAAACACATTTAAATGCCTTATCATCAGCACCTTT[A/G]
TGGGTTCTCACCACATGCATTAATCTGTATTTAGCTCTTGCACTATCTTT
  
Genomic location of solcap_snp_sl_42471  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23307 marker 23307
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)