SGN Marker solcap_snp_sl_42542

SGN-M23310

Synonyms  
CL015910-0448
CL015910-0448_SGN-U323620_snp469_Ovate_SNP2_solcap_snp_sl_42542
Ovate_SNP2
SGN-U323620_snp469
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59641)
Chromosome
2
Position
42.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAGTCATCGCTTGAGAAATCGTAACAGCTTCTGGAAGATGAAACTAAAG
  
3' flanking region
TTCAGTTTCCTCTTCATTATTATCCCAATCAGTATTAGTACCGCTTAATA
SNP nucleotide
AT
SNPdb format
TGAGTCATCGCTTGAGAAATCGTAACAGCTTCTGGAAGATGAAACTAAAG[A/T]
TTCAGTTTCCTCTTCATTATTATCCCAATCAGTATTAGTACCGCTTAATA
  
Genomic location of solcap_snp_sl_42542  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23310 marker 23310
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)