SGN Marker solcap_snp_sl_42625

SGN-M23312

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68881)
Chromosome
2
Position
76.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65255)
Chromosome
2
Position
107.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59643)
Chromosome
2
Position
42.63 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTGTCTTTTCCATTGTCTGCAGTGCTTCGGGTAGAAAAGGGAAGCAA
  
3' flanking region
TGCTTCTGTCGGCAAGTCTCAATGGCCCCTTTATACATATCCTCCAAAGT
SNP nucleotide
TC
SNPdb format
TCTTTGTCTTTTCCATTGTCTGCAGTGCTTCGGGTAGAAAAGGGAAGCAA[T/C]
TGCTTCTGTCGGCAAGTCTCAATGGCCCCTTTATACATATCCTCCAAAGT
  
Genomic location of solcap_snp_sl_42625  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23312 marker 23312
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)