SGN Marker solcap_snp_sl_42681

SGN-M23315

Synonyms  
SGN-U568929_snp230
SGN-U568929_snp230_solcap_snp_sl_42681
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66928)
Chromosome
2
Position
75.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63410)
Chromosome
2
Position
106.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59646)
Chromosome
2
Position
42.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGATTGAAAACTCGACAAACAGGCAGGTCACTTACTCCAAGAGAAGAAA
  
3' flanking region
GGTATTTTCAAGAAAGCTAAAGAACTTACTGTTCTTTGTGACGCTAAGAT
SNP nucleotide
TC
SNPdb format
AAGATTGAAAACTCGACAAACAGGCAGGTCACTTACTCCAAGAGAAGAAA[T/C]
GGTATTTTCAAGAAAGCTAAAGAACTTACTGTTCTTTGTGACGCTAAGAT
  
Genomic location of solcap_snp_sl_42681  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23315 marker 23315
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)