SGN Marker solcap_snp_sl_4283

SGN-M23329

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59660)
Chromosome
1
Position
88.25 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACATTGACAATGGCAATTTGGAGCAATGGCTACACGGTGATGTAGGGTC
  
3' flanking region
GTTAGTCCTCTAACTTGGGAAATCAGACTGAGAATTGCAATTGGAACTGC
SNP nucleotide
AT
SNPdb format
TACATTGACAATGGCAATTTGGAGCAATGGCTACACGGTGATGTAGGGTC[A/T]
GTTAGTCCTCTAACTTGGGAAATCAGACTGAGAATTGCAATTGGAACTGC
  
Genomic location of solcap_snp_sl_4283  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23329 marker 23329
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)