SGN Marker solcap_snp_sl_42942

SGN-M23345

Synonyms  
CL017070-0308
CL017070-0308_solcap_snp_sl_42942
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59676)
Chromosome
12
Position
33.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCAAAATCGCTGTCAGATCCATTCCTCTTCCCCTTTCACGATTCCTCTT
  
3' flanking region
TATTTTTGCAGGTCATGACTGAAACCCATGAGCTCGGAACCATGAAACAA
SNP nucleotide
CG
SNPdb format
ACCAAAATCGCTGTCAGATCCATTCCTCTTCCCCTTTCACGATTCCTCTT[C/G]
TATTTTTGCAGGTCATGACTGAAACCCATGAGCTCGGAACCATGAAACAA
  
Genomic location of solcap_snp_sl_42942  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23345 marker 23345
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)