SGN Marker solcap_snp_sl_43021

SGN-M23357

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72890)
Chromosome
9
Position
29.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68896)
Chromosome
9
Position
48.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65269)
Chromosome
9
Position
66.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59688)
Chromosome
9
Position
59.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGGCCCAACTTGGATTTCAGTATCATCTTCCTCGTCATCTAGTTCCTC
  
3' flanking region
ATTACTGCTGAGTCGCAGCAGTTGAAAACAACCTACTAGTCTACAACTCA
SNP nucleotide
AG
SNPdb format
AATGGCCCAACTTGGATTTCAGTATCATCTTCCTCGTCATCTAGTTCCTC[A/G]
ATTACTGCTGAGTCGCAGCAGTTGAAAACAACCTACTAGTCTACAACTCA
  
Genomic location of solcap_snp_sl_43021  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23357 marker 23357
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)