SGN Marker solcap_snp_sl_43152

SGN-M23366

Synonyms  
SGN-U580685_snp964
SGN-U580685_snp964_solcap_snp_sl_43152
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70456)
Chromosome
9
Position
25.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66986)
Chromosome
9
Position
47.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63462)
Chromosome
9
Position
66.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59697)
Chromosome
9
Position
58.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGACTGATCTTTACAACCGAAAATTAAAGGTAGTTCTTTTTACAAAGGTA
  
3' flanking region
GTGACAAGCCTATTGCACCACATAAACCTTCCAAGAAAAGCTTCATTACT
SNP nucleotide
TC
SNPdb format
TGACTGATCTTTACAACCGAAAATTAAAGGTAGTTCTTTTTACAAAGGTA[T/C]
GTGACAAGCCTATTGCACCACATAAACCTTCCAAGAAAAGCTTCATTACT
  
Genomic location of solcap_snp_sl_43152  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23366 marker 23366
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)