SGN Marker solcap_snp_sl_43180

SGN-M23369

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72897)
Chromosome
9
Position
24.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68902)
Chromosome
9
Position
47.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65275)
Chromosome
9
Position
65.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59700)
Chromosome
9
Position
58.55 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCCGCCATAGGATTAGCCGCTCCAGCCCCACTTTGAATTGCTATACCAT
  
3' flanking region
CGAGTCTAATTCAGCTTCATCATTTTCATCCTCGTCATCCTCAGCCTCGT
SNP nucleotide
TC
SNPdb format
AGCCGCCATAGGATTAGCCGCTCCAGCCCCACTTTGAATTGCTATACCAT[T/C]
CGAGTCTAATTCAGCTTCATCATTTTCATCCTCGTCATCCTCAGCCTCGT
  
Genomic location of solcap_snp_sl_43180  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23369 marker 23369
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)