SGN Marker CT188

SGN-M234

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTGTTTTAGACAGCACAAAGATTCATATTCAAAGTTTCTCACAAGAAGAAAAGGACTAAAAGCTCATGTGAAACAGAC
CACGCTCAATCATCAAACACATGCCAACTCTGAAATATATGGGAGAATGGCATATTTATTCTGGTCATTATAAAACAGAAATGAGCCAAT
CCGCTTCTTATTCCTCCTCTTGTCCAAGAAAAGCCACCAGCATATTCTCATAATCTCCTCCTGTATCTTTGGCAATGGCGCGACCCAGAG
GAACGCTATCCCTCTTCTGGAACTCGTTAGCGATAGTCTTCAGATCGACCTCAGCCCTTGTAGCGATAACTCGGGGTAGATGATCTTCCT
CTGTTCCTCTCCTGTTAATTGCATCACGAAGAACCTCCACGAAATAGTGCTCGGGGTAGACAAGACCTTTTATGGTGGCCCTTAACAGTG
CAACAAACTCATCCTCATCTTCTAATTGCTTTAGGATATCCTCACCATATTC
Reverse sequence
TTTTTTTTTTTTAAAACAGTGAATATTTAAGGCATAGATAGATCAAACGGTACAGCCGAGCTTTTTAGCAAAATCTGAAATTATGAATTC
CCAATCATATCCTCCTCCTGCCCACACAGAGAAGAAGAAAAATGGCAAGTCTTACAGTTCCGGCAGAAGTTCCTTCAGTCGCTGAAGACT
GTGAACAACTCCGATCTGCCTTCAAAGGATGGGGAACGAATGAGAAGTTGATTATATCAATTTTGGCTCATAGAAATGCGGCTCAACGCA
AATTGATTCGACAGACTTATGCTGAGACTTTTGGGGAAGATCTGCTTAAAGAGTTGGACAGAGAACTTACTCATGATTTTGAGAAATTGG
TGGTAGTATGGACACTGGATCCTGCAGAACGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1598762.9e-2769 (13.7% of RFLP seq)+
SGN-U144717487 (97.0% of RFLP seq)+
SGN-U1612212e-1541 (10.5% of RFLP seq)-
SGN-U1437835.8e-2878 (19.9% of RFLP seq)-
SGN-U1612213e-147262 (66.8% of RFLP seq)-
SGN-U1447171e-170301 (76.8% of RFLP seq)-
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42955)
Chromosome
4
Position
42.20 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43955
Forward primer (5'-3')
ATCCTCCTCCTGCCCACACA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GTTGCTTTTTGTCCATCTCTTAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42314)
Chromosome
4
Position
73.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39000)
Chromosome
4
Position
88.40 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8697)
Chromosome
4
Position
51.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8696)
Chromosome
4
Position
71.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8699)
Chromosome
4
Position
42.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT188 was used as an overgo probe on plate 9 [well D9]

Plausible BAC Matches:   P191A17,   P222K18

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCGCTTCTTATTCCTCCTCTTGTC
B sequence
CTGGTGGCTTTTCTTGGACAAGAG
AB sequence
CCGCTTCTTATTCCTCCTCTTGTCCAAGAA
Marker sequence
CTTTTTTTTTTTTTGTTTTAGACAGCACAAAGATTCATATTCAAAGTTTC
TCACAAGAAGAAAAGGACTAAAAGCTCATGTGAAACAGACCACGCTCAAT
CATCAAACACATGCCAACTCTGAAATATATGGGAGAATGGCATATTTATT
CTGGTCATTATAAAACAGAAATGAGCCAATCCGCTTCTTATTCCTCCTCT
TGTCCAAGAAAAGCCACCAGCATATTCTCATAATCTCCTCCTGTATCTTT
GGCAATGGCGCGACCCAGAGGAACGCTATCCCTCTTCTGGAACTCGTTAG
CGATAGTCTTCAGATCGACCTCAGCCCTTGTAGCGATAACTCGGGGTAGA
TGATCTTCCTCTGTTCCTCTCCTGTTAATTGCATCACGAAGAACCTCCAC
GAAATAGTGCTCGGGGTAGACAAGACCTTTTATGGTGGCCCTTAACAGTG
CAACAAACTCATCCTCATCTTCTAATTGCTTTAGGATATCCTCACCATAT
TC
Genomic location of CT188  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D234 marker 234
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)