SGN Marker solcap_snp_sl_4431

SGN-M23435

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72936)
Chromosome
8
Position
28.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68931)
Chromosome
8
Position
20.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65298)
Chromosome
8
Position
32.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59766)
Chromosome
8
Position
50.44 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTCCAATCCATTGATCCTCCATAGCAGAGCCTGTTCAGGCAATTAGCAA
  
3' flanking region
AAAAGAATAGCTGTTGCAAGTGAATATATTGTACGATTTGTGCTCAAAAT
SNP nucleotide
CG
SNPdb format
GTTCCAATCCATTGATCCTCCATAGCAGAGCCTGTTCAGGCAATTAGCAA[C/G]
AAAAGAATAGCTGTTGCAAGTGAATATATTGTACGATTTGTGCTCAAAAT
  
Genomic location of solcap_snp_sl_4431  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23435 marker 23435
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)