SGN Marker solcap_snp_sl_44470

SGN-M23443

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72939)
Chromosome
1
Position
99.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68934)
Chromosome
1
Position
90.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65301)
Chromosome
1
Position
147.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59774)
Chromosome
1
Position
82.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTAAAGTCAGATGCAACACTAGCAATAACACGGAAACCTCTCTTTGAGG
  
3' flanking region
CCCCATCGGGTTAATGCCATTAAAATTTCTTGAAAAAACCCTAGATTGAC
SNP nucleotide
TC
SNPdb format
CCTAAAGTCAGATGCAACACTAGCAATAACACGGAAACCTCTCTTTGAGG[T/C]
CCCCATCGGGTTAATGCCATTAAAATTTCTTGAAAAAACCCTAGATTGAC
  
Genomic location of solcap_snp_sl_44470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23443 marker 23443
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)