Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_44607

SGN-M23455

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72945)
Chromosome
6
Position
9.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59786)
Chromosome
6
Position
30.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCAGCACCGCGGAGCCTACTGAAAGCGGTGGTTTCTGGACTGTTACTAA
  
3' flanking region
GATGTTACCAGGTACTCGTCCCTCCTTGCCAAACAGGATATTTCTCTTTC
SNP nucleotide
AG
SNPdb format
ACCAGCACCGCGGAGCCTACTGAAAGCGGTGGTTTCTGGACTGTTACTAA[A/G]
GATGTTACCAGGTACTCGTCCCTCCTTGCCAAACAGGATATTTCTCTTTC
  
Genomic location of solcap_snp_sl_44607  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23455 marker 23455
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)