Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_44650

SGN-M23459

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72948)
Chromosome
6
Position
10.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68938)
Chromosome
6
Position
16.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65305)
Chromosome
6
Position
24.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59790)
Chromosome
6
Position
31.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTTTTATGACAAGGCCAGCTTGTCTGCTTTAAAATCTAACCCAGAGAAG
  
3' flanking region
AGCATGCAGATTTTGCTGTTAAGTATCCTACACTTGTACCTACCCTTGAA
SNP nucleotide
AG
SNPdb format
ACTTTTATGACAAGGCCAGCTTGTCTGCTTTAAAATCTAACCCAGAGAAG[A/G]
AGCATGCAGATTTTGCTGTTAAGTATCCTACACTTGTACCTACCCTTGAA
  
Genomic location of solcap_snp_sl_44650  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23459 marker 23459
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)