Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_44776

SGN-M23472

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68946)
Chromosome
9
Position
3.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59803)
Chromosome
9
Position
0.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATTTGCTCCAAGTCTTTGCCAACTTCGTTGGAGAATGAAAGAAATGCAG
  
3' flanking region
CGAATTGATCTTGGATAAACCACATTACCTTCATTGTTGCCTCAAACTGA
SNP nucleotide
AC
SNPdb format
AATTTGCTCCAAGTCTTTGCCAACTTCGTTGGAGAATGAAAGAAATGCAG[A/C]
CGAATTGATCTTGGATAAACCACATTACCTTCATTGTTGCCTCAAACTGA
  
Genomic location of solcap_snp_sl_44776  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23472 marker 23472
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)