SGN Marker solcap_snp_sl_44863

SGN-M23490

Synonyms  
CL017584-0236
CL017584-0236_solcap_snp_sl_44863
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59821)
Chromosome
11
Position
52.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAAAACGATCGCCGGTTGCTTCGTCCATTGGTATGTGACGCTTGCTGGC
  
3' flanking region
TCTATATGGACTATAAGCCGGACTCCGACTCCGACTCCCGCTAACACTTC
SNP nucleotide
TC
SNPdb format
AGAAAACGATCGCCGGTTGCTTCGTCCATTGGTATGTGACGCTTGCTGGC[T/C]
TCTATATGGACTATAAGCCGGACTCCGACTCCGACTCCCGCTAACACTTC
  
Genomic location of solcap_snp_sl_44863  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23490 marker 23490
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)