SGN Marker solcap_snp_sl_44877

SGN-M23494

Synonyms  
SL1_00sc6004_2043850
SL1_00sc6004_2043850_solcap_snp_sl_44877
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70585)
Chromosome
11
Position
84.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59825)
Chromosome
11
Position
52.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAACTGGTCGTGTGGGGTGTTCAGCTCACAGAAGTACATGGCTTCAACAA
  
3' flanking region
TCGAGGTTTACTCTGGAGAACAGCAGCCCTGCAGGCATCCTTAACAACGG
SNP nucleotide
CG
SNPdb format
CAACTGGTCGTGTGGGGTGTTCAGCTCACAGAAGTACATGGCTTCAACAA[C/G]
TCGAGGTTTACTCTGGAGAACAGCAGCCCTGCAGGCATCCTTAACAACGG
  
Genomic location of solcap_snp_sl_44877  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23494 marker 23494
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)