SGN Marker TG285

SGN-M235

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG285 image not available
Forward sequence
AAGAAACCATATTTAATTAACTCATGAAAACTGAAGGGAGCTAGGCAACTACTGAAAATTGACAAGAGACAACCCTGAGTACAAAAAAAA
ACTTCATTTGAGGTTTGCCATGTCAGAAGCTTGTTTACTACACAATCCAAATGAACAAAGAAAATAAAAGTTGGCATGGACAAGCAAAAG
TATTACCTACACATCTAAGTTTATGCAATTAAAAATGAGTATATTAGGGACCAAGCATTGAGGTTGACATTGAACTCCAAAGAGAAATTT
TAACACACCCTTCTACTTATGAGACCAAGCAAATGTTGATGCCCTCGATGGGAAAGCACTAATAAGAACTTAAATAGGTCCCTGCTAGCC
CTCCCTCCCACAATCTGTGCCCCTGATTTCTTTTAAGTGATGTTTCGTCCCCTTGTTGAACATATACAGTATCAATATACAGGAGTATGC
AATAAAAAGATCTCTGTGAAAAAGAGCAATGAAGCAAGGATTTAAACAGCTAGATAGTT
Reverse sequence
CTCCTATAGGGAGACAGTCTGCATGCCTGAAGCTCGGTCACGAGCAAGAAAGCAGGTCCTTTTGCTTATTTTGCATCTTCTGTGATATTG
TTTTTCATCTATGCGCCAGTGAAATTTTACTCTTCTGATTAACAGGCTTACACCCATGAACTAGAGAACAAAGTTTCATTTCTTGAAGAG
GAGAATGAAAGACTGAAGAGACAGAAGGTAGGATTGCAATCAAAATAATTCATGCATGAATTCAGTGATATCATTTTCTTCAAACAGTTA
TACATTCTCATTAGTTCCATGTTGGTTGTAATAATCAATCTTTCTCTGGGGAAGAAACTATAGTAGCTGAATCTGGTCTATGAATGCTGT
GACGCTCTAACTTCTTTAAGTTCATTGGCTAAATCTTTAAATGGACAAGATATTTTCCTTCACAATGAAACATGCTATTAATCATTTATG
CGATCAGGAGGAAGTACAGTTGGTGATTCATGCCTTCTTTTGTTTCTTTTTCCCCTTAAGACGATTAATCAATTAGCAGAGCCTTTATAT
TAACAAGTGATTTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53252)
Chromosome
10
Position
74.61 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42434)
Chromosome
10
Position
133.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39979)
Chromosome
10
Position
45.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8701)
Chromosome
10
Position
111.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8700)
Chromosome
10
Position
43.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8705)
Chromosome
10
Position
44.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG285 was used as an overgo probe on plate 14 [well E3]

Plausible BAC Matches:   P234C10

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCCTTCTACTTATGAGACCAAGCA
B sequence
CGAGGGCATCAACATTTGCTTGGT
AB sequence
CCCTTCTACTTATGAGACCAAGCAAATGTT
Marker sequence
AAGAAACCATATTTAATTAACTCATGAAAACTGAAGGGAGCTAGGCAACT
ACTGAAAATTGACAAGAGACAACCCTGAGTACAAAAAAAAACTTCATTTG
AGGTTTGCCATGTCAGAAGCTTGTTTACTACACAATCCAAATGAACAAAG
AAAATAAAAGTTGGCATGGACAAGCAAAAGTATTACCTACACATCTAAGT
TTATGCAATTAAAAATGAGTATATTAGGGACCAAGCATTGAGGTTGACAT
TGAACTCCAAAGAGAAATTTTAACACACCCTTCTACTTATGAGACCAAGC
AAATGTTGATGCCCTCGATGGGAAAGCACTAATAAGAACTTAAATAGGTC
CCTGCTAGCCCTCCCTCCCACAATCTGTGCCCCTGATTTCTTTTAAGTGA
TGTTTCGTCCCCTTGTTGAACATATACAGTATCAATATACAGGAGTATGC
AATAAAAAGATCTCTGTGAAAAAGAGCAATGAAGCAAGGATTTAAACAGC
TAGATAGTT
Genomic location of TG285  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D235 marker 235
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)