SGN Marker solcap_snp_sl_44932

SGN-M23504

Synonyms  
SL1_00sc6004_2258368
SL1_00sc6004_2258368_solcap_snp_sl_44932
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70595)
Chromosome
11
Position
87.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67081)
Chromosome
11
Position
92.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63548)
Chromosome
11
Position
104.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59835)
Chromosome
11
Position
52.44 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCACCGGATTCGGCGATTGGTGCAGGATAAAATCCCCGCCGTTGCCGGC
  
3' flanking region
CAAGTGAGATTAGACAGTACGGTGAGATTCAGCTGCGTGGGGATCGGAGA
SNP nucleotide
CG
SNPdb format
AGCACCGGATTCGGCGATTGGTGCAGGATAAAATCCCCGCCGTTGCCGGC[C/G]
CAAGTGAGATTAGACAGTACGGTGAGATTCAGCTGCGTGGGGATCGGAGA
  
Genomic location of solcap_snp_sl_44932  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23504 marker 23504
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)