Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_44936

SGN-M23506

Synonyms  
SL1_00sc6004_2266753
SL1_00sc6004_2266753_solcap_snp_sl_44936
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70596)
Chromosome
11
Position
87.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59837)
Chromosome
11
Position
52.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAAGAAATAATTGAAATAATCTGAATAAACAACATGCTTATACAATGGT
  
3' flanking region
TCTCTCCATTTTCTAGCACTTGTGTCAAAGGACCAAAAACTGCATCAGGT
SNP nucleotide
TG
SNPdb format
TGAAGAAATAATTGAAATAATCTGAATAAACAACATGCTTATACAATGGT[T/G]
TCTCTCCATTTTCTAGCACTTGTGTCAAAGGACCAAAAACTGCATCAGGT
  
Genomic location of solcap_snp_sl_44936  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23506 marker 23506
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)