SGN Marker solcap_snp_sl_45078

SGN-M23519

Synonyms  
2486_1_90c
2486_1_90c_solcap_snp_sl_45078
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59850)
Chromosome
9
Position
5.90 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTTCTCCTTCTCCTTCTCCTTCTCCTTGTCCTTTATTGCAACGCGACC
  
3' flanking region
TCAGTTCCAGCAAGTATTGCATACTTATCTCTTCTTGTCAAATTAGTACA
SNP nucleotide
AG
SNPdb format
TTCTTCTCCTTCTCCTTCTCCTTCTCCTTGTCCTTTATTGCAACGCGACC[A/G]
TCAGTTCCAGCAAGTATTGCATACTTATCTCTTCTTGTCAAATTAGTACA
  
Genomic location of solcap_snp_sl_45078  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23519 marker 23519
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)