SGN Marker solcap_snp_sl_45174

SGN-M23531

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72977)
Chromosome
9
Position
21.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68957)
Chromosome
9
Position
44.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65323)
Chromosome
9
Position
64.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59862)
Chromosome
9
Position
8.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGTTTCGATCCCATTATGGTTCTTTCAGTCCTATTTCACCATTTCCTTC
  
3' flanking region
ATGACATGTGACTTGAGGGGACCTAATGCAATGGCAGAGGATGAAAAGGC
SNP nucleotide
AG
SNPdb format
TCGTTTCGATCCCATTATGGTTCTTTCAGTCCTATTTCACCATTTCCTTC[A/G]
ATGACATGTGACTTGAGGGGACCTAATGCAATGGCAGAGGATGAAAAGGC
  
Genomic location of solcap_snp_sl_45174  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23531 marker 23531
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)