SGN Marker solcap_snp_sl_45214

SGN-M23544

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72986)
Chromosome
8
Position
27.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59875)
Chromosome
8
Position
29.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTCCACTGCTACCAGAATGAAATAATAGGTAGACAGACACTTGTGTCAC
  
3' flanking region
GACTAAGAGTCTCACTGATATCTCATGCGCGGGACATGACAGTTGGCTGG
SNP nucleotide
AG
SNPdb format
AGTCCACTGCTACCAGAATGAAATAATAGGTAGACAGACACTTGTGTCAC[A/G]
GACTAAGAGTCTCACTGATATCTCATGCGCGGGACATGACAGTTGGCTGG
  
Genomic location of solcap_snp_sl_45214  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23544 marker 23544
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)