SGN Marker solcap_snp_sl_457

SGN-M23618

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73033)
Chromosome
1
Position
51.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68989)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59949)
Chromosome
1
Position
71.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCGTCATCTGGGTCGTCGGATAACTCATCCACACAGTTCTCGAGAGAGA
  
3' flanking region
AATGAAGCTACTTTCGTCTGGTAGTGGGTCACCGGGTCGTGATGAACCCG
SNP nucleotide
AG
SNPdb format
TTCGTCATCTGGGTCGTCGGATAACTCATCCACACAGTTCTCGAGAGAGA[A/G]
AATGAAGCTACTTTCGTCTGGTAGTGGGTCACCGGGTCGTGATGAACCCG
  
Genomic location of solcap_snp_sl_457  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23618 marker 23618
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)