SGN Marker solcap_snp_sl_46590

SGN-M23673

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73070)
Chromosome
9
Position
33.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69011)
Chromosome
9
Position
50.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65377)
Chromosome
9
Position
69.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60004)
Chromosome
9
Position
61.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGCTCATAGCATACCAGGGCCCTCCAGGAAGACGTAAACCTTGGCGCTG
  
3' flanking region
CCAATAGTATAGAACCAAAAACCACGGTGGTTTCCAAGATAATCTCCATT
SNP nucleotide
AG
SNPdb format
GAGCTCATAGCATACCAGGGCCCTCCAGGAAGACGTAAACCTTGGCGCTG[A/G]
CCAATAGTATAGAACCAAAAACCACGGTGGTTTCCAAGATAATCTCCATT
  
Genomic location of solcap_snp_sl_46590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23673 marker 23673
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)