SGN Marker solcap_snp_sl_46592

SGN-M23674

Synonyms  
SGN-U600027_snp44507
SGN-U600027_snp44507_solcap_snp_sl_46592
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70493)
Chromosome
9
Position
34.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67019)
Chromosome
9
Position
50.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63491)
Chromosome
9
Position
69.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60005)
Chromosome
9
Position
61.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGTGGCTTTCTTCTCGTCTTTCTTTGGAACTTTAGTTTGCTTTCTATG
  
3' flanking region
TGTACCTGGCAGCTCTCTTTCTGTATGCGCTTTGTGTGAACACTGGGCCA
SNP nucleotide
CG
SNPdb format
ATTGTGGCTTTCTTCTCGTCTTTCTTTGGAACTTTAGTTTGCTTTCTATG[C/G]
TGTACCTGGCAGCTCTCTTTCTGTATGCGCTTTGTGTGAACACTGGGCCA
  
Genomic location of solcap_snp_sl_46592  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23674 marker 23674
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)