Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_46681

SGN-M23679

Synonyms  
SGN-U604585_snp17488
SGN-U604585_snp17488_solcap_snp_sl_46681
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60010)
Chromosome
9
Position
61.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGGATCTGATGCATTTGAACTTGCTGCAAAGTTTTGCTATGGAGTGAAC
  
3' flanking region
TAGAGATAACCATATTAAACGTGGCATTACTAAGATGTGCAGCCAAGTTC
SNP nucleotide
AG
SNPdb format
GTGGATCTGATGCATTTGAACTTGCTGCAAAGTTTTGCTATGGAGTGAAC[A/G]
TAGAGATAACCATATTAAACGTGGCATTACTAAGATGTGCAGCCAAGTTC
  
Genomic location of solcap_snp_sl_46681  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23679 marker 23679
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)