SGN Marker solcap_snp_sl_46782

SGN-M23682

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73073)
Chromosome
9
Position
38.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69013)
Chromosome
9
Position
52.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60013)
Chromosome
9
Position
62.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTAAAAGAGTCGGTGCGAGGTTTTTGCTAACCAGCACTAGCGAAGTATA
  
3' flanking region
GGTGATCCTTTAGAACATCCACAGAAGGAGACATACTGGGGCAATGTTAA
SNP nucleotide
TC
SNPdb format
GCTAAAAGAGTCGGTGCGAGGTTTTTGCTAACCAGCACTAGCGAAGTATA[T/C]
GGTGATCCTTTAGAACATCCACAGAAGGAGACATACTGGGGCAATGTTAA
  
Genomic location of solcap_snp_sl_46782  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23682 marker 23682
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)