SGN Marker solcap_snp_sl_46905

SGN-M23690

Synonyms  
CL015431-0255
CL015431-0255_solcap_snp_sl_46905
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60021)
Chromosome
9
Position
62.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTCCAAAGGGAACGTCTCGCTAGGAATTAACCATCCAAGTGGGCCCCA
  
3' flanking region
GACCATGCGAAAGCCGATACATATGTACAGATCAGAACTACTACGAAGAT
SNP nucleotide
TC
SNPdb format
GTTTCCAAAGGGAACGTCTCGCTAGGAATTAACCATCCAAGTGGGCCCCA[T/C]
GACCATGCGAAAGCCGATACATATGTACAGATCAGAACTACTACGAAGAT
  
Genomic location of solcap_snp_sl_46905  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23690 marker 23690
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)