SGN Marker TG359

SGN-M237

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGTTACATATTCTTTTTTGACAGAATGGTAGTAAATGTAACCCCAAAAGTTTATGCATT
GAGAAGAAATGAATGAAGTAAAAATAAGAGAGGGCATACCACAGATTCCTGAAACTCAGCTCCTAGATACCCACTGGAAGCCATGGAACG
GTTATCGTACAGCAGATAGTATGCAACAGTAGCCTGAAACAGACACATAAAGATATAAAGCAAACTGAAGTAATTAAAAGGTCTACCAAT
TACCACACCTCATCCCTTTGCAATCAATTTCTAATGTAGAAATGTAAAACACAAATATATCTACAATTGCTAGATTCTTTCCCTTTTTCA
GTACCATATTATTAGCCATATACAATAGAGAAAACCCAAAAGAAAAGAAAAGTAGTTACAACAAGAAACAGAGTGCCGCTAGTGTTGTAA
GAAGCAACGTACATCATCTTGTATTCTCTTTTGTAAAGAATCAAGCAACTGGTCCCTATCAAGCCCCATCCTAGTTACTTGCTGGAGAAT
TTCCTCATCAAGCTGC
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGTTAACATATTCTTTTTTGACAGAATGGTAGTAAATGTAACCCCAAAAGTTTATGCAT
TGAGAAGAAATGAATGAAGTAAAAATAAGAGAGGGCATACCACAGATTCCTGAAACTCAGCTCCTAGATACCCACTGGAAGCCATGGAAC
GGTTATCGTACAGCAGATAGTATGCAACAGTAGCCTGAAACAGACACATAAAGATATAAAGCAAACTGAAGTAATTAAAAGGTCTACCAA
TTACCACACCTCATCCCTTTGCAATCAATTTCTAATGTAGAAATGTAAAACACAAATATATCTACAATTGCTAGATTCTTTCCCTTTTTC
AGTACCATATTATTAGCCATATACAATAGAGAAAACCCAAAAGAAAAGAAAAGTAGTTACAACAAGAAACAGAGTGCCGCTAGTGTTGTA
AGAAGCAACGTACATCATCTTGTATTCTCTTTTGTAAAGAATCAAGCAACTGGTCCCTATCAAGCCCCATCCTAGTTACTTGCTGGAGAA
TTTCCTCATCAAGCTGCAGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1463001.6e-4185 (15.3% of RFLP seq)+
SGN-U1463002.6e-4693 (16.7% of RFLP seq)+
SGN-U1463001.6e-4185 (15.2% of RFLP seq)-
SGN-U1463002.6e-4693 (16.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8709)
Chromosome
3
Position
87.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8710)
Chromosome
3
Position
99.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG359 was used as an overgo probe on plate 2 [well H4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P231L17,   P092F05,   P120P13,   P130M23

 Overgo Sequences

A sequence
GGGCATACCACAGATTCCTGAAAC
B sequence
GGTATCTAGGAGCTGAGTTTCAGG
AB sequence
GGGCATACCACAGATTCCTGAAACTCAGCT
Marker sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGTTACATATTCTTTTTTG
ACAGAATGGTAGTAAATGTAACCCCAAAAGTTTATGCATTGAGAAGAAAT
GAATGAAGTAAAAATAAGAGAGGGCATACCACAGATTCCTGAAACTCAGC
TCCTAGATACCCACTGGAAGCCATGGAACGGTTATCGTACAGCAGATAGT
ATGCAACAGTAGCCTGAAACAGACACATAAAGATATAAAGCAAACTGAAG
TAATTAAAAGGTCTACCAATTACCACACCTCATCCCTTTGCAATCAATTT
CTAATGTAGAAATGTAAAACACAAATATATCTACAATTGCTAGATTCTTT
CCCTTTTTCAGTACCATATTATTAGCCATATACAATAGAGAAAACCCAAA
AGAAAAGAAAAGTAGTTACAACAAGAAACAGAGTGCCGCTAGTGTTGTAA
GAAGCAACGTACATCATCTTGTATTCTCTTTTGTAAAGAATCAAGCAACT
GGTCCCTATCAAGCCCCATCCTAGTTACTTGCTGGAGAATTTCCTCATCA
AGCTGC
Genomic location of TG359  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D237 marker 237
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)