Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_47713

SGN-M23735

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73104)
Chromosome
4
Position
90.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60066)
Chromosome
4
Position
62.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGCGATACTATTGCAAAACGAGGGGGTCGTCTAGCTGGTGCAGGAATT
  
3' flanking region
TTGGTATATTACAGAAAATGGAGGAAGATTCTAAAGGTCTCATCTTTGGT
SNP nucleotide
AG
SNPdb format
TTTGCGATACTATTGCAAAACGAGGGGGTCGTCTAGCTGGTGCAGGAATT[A/G]
TTGGTATATTACAGAAAATGGAGGAAGATTCTAAAGGTCTCATCTTTGGT
  
Genomic location of solcap_snp_sl_47713  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23735 marker 23735
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)