SGN Marker solcap_snp_sl_48121

SGN-M23780

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73130)
Chromosome
1
Position
124.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60111)
Chromosome
1
Position
88.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAGACACTGTGAAGAGAATATGATGAGAGGAGTGCTCCGGAAACTTGGG
  
3' flanking region
CGATATGCACATTGACATTATTTGCTAGAGCATTCACATGCACTTGGCAT
SNP nucleotide
TG
SNPdb format
GGAGACACTGTGAAGAGAATATGATGAGAGGAGTGCTCCGGAAACTTGGG[T/G]
CGATATGCACATTGACATTATTTGCTAGAGCATTCACATGCACTTGGCAT
  
Genomic location of solcap_snp_sl_48121  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23780 marker 23780
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)