SGN Marker solcap_snp_sl_4829

SGN-M23792

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73139)
Chromosome
2
Position
53.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60123)
Chromosome
2
Position
41.73 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCACGCCATTTGTGCTCTTCTCATGAAGGGAAAAATAGGACTGAATAAT
  
3' flanking region
CGCAGTTTTGGACTATCCTCCACTTGAGCCTTTGGGATAACATGGTCTTT
SNP nucleotide
AT
SNPdb format
GCCACGCCATTTGTGCTCTTCTCATGAAGGGAAAAATAGGACTGAATAAT[A/T]
CGCAGTTTTGGACTATCCTCCACTTGAGCCTTTGGGATAACATGGTCTTT
  
Genomic location of solcap_snp_sl_4829  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23792 marker 23792
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)