SGN Marker solcap_snp_sl_4831

SGN-M23793

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73140)
Chromosome
2
Position
53.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65421)
Chromosome
2
Position
104.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60124)
Chromosome
2
Position
41.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GACTCAAACTGACGTTACTTGGAAGCTAGAGATGGAGAAAAGCCAGTCCC
  
3' flanking region
AGTGGATGCTTTACAAGCAAAACTGTTGGAGGTAAAAGCTTCTATTCAGG
SNP nucleotide
AC
SNPdb format
GACTCAAACTGACGTTACTTGGAAGCTAGAGATGGAGAAAAGCCAGTCCC[A/C]
AGTGGATGCTTTACAAGCAAAACTGTTGGAGGTAAAAGCTTCTATTCAGG
  
Genomic location of solcap_snp_sl_4831  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23793 marker 23793
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)