SGN Marker TG288

SGN-M238

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG288 image not available
Forward sequence
TAGCAGTTTCCCAGATTATGAAAAGTTGCATGCGAAGAAATACAATGTAACCAGAGCAGAAACTAATAAAGCAAACGAGTAAATATGCAT
TTATATATTTTGTCCTCTTCTTCTTTTTCCTCTTTCAATTAGTTCAAACCTTCTCCTCAACTTATGGGTTACTATATGACAAATATTTGT
ATTCTGGGTATATGACCAATAGACATGAGAAAACAAAAACTGACGTGCGCCACCTACAAAGCAAAAAAATTGTACAGTAAACAGAACGCT
GCTGGTCTGTCTAGGACCGTACCTTAAAGCAAAAAAGGGGGATTTCGTAGAGCAAAATTAAATGTCAAATTCGTTTTTCTTTGTCAAGTT
ATACAACTGATTTTTTTTTTTGGACTAACCTTGATTAAGAAGCTTGCGATGAGGACCAACATTGGTGTTACCAGTGATGGCTGAATTTGC
GTCCGCCATGAAATTGGGACCAATAAGTATGCCTGGAATCAAAGTCGATTAATGAAGCATTAAAGA
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGTTTTGCAGTCTCTGTAGCAGTGTGTGCGCGACGAGCTTGCTCTTTCAGCAAAGTACCGTACGTGTA
GGATCATCGAAAACTGGTGAGAAATATCGACCTTCATTCATATTTACTGCAATTATACATACAGGCTTTTTCTTTGCTTTGCTTCCACTG
TTTTGGTATTTATGGCGTTTGTTGAAACTGTGTTGTTTGTCTCACTGAGACTGAGGGAAAAAAGCTTCACTGTTGCTTTTGCGAACTCTG
TACATTTTGTCTCTGTTCATTCCACTTTTTTTTTTCTTATTTGAATGTGCTCTTAATTAGCTTCTTCTTCTGTTACTTTCTTCTTCGTGT
TGTTCGGCGCTTTTATTGATTTGATGGGTGAGTTTATAGCATTTTTTTATTTACCTTCTCAAAAAGTATGTAATGGTACATATATATTTG
CTTTATGTCAACTCATACTTTTTAAGTTTATCAAGTCATTTCACGCATCTCTCATAGCACTTTTTCATTTTTCTCTCTGTTATTTCAGTC
TAAGACCGAGTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8711)
Chromosome
3
Position
57.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG288 was used as an overgo probe on plate 5 [well H8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P049I01,   P169H11,   P199E09

 Overgo Sequences

A sequence
TTGCGATGAGGACCAACATTGGTG
B sequence
CAGCCATCACTGGTAACACCAATG
AB sequence
TTGCGATGAGGACCAACATTGGTGTTACCA
Marker sequence
TAGCAGTTTCCCAGATTATGAAAAGTTGCATGCGAAGAAATACAATGTAA
CCAGAGCAGAAACTAATAAAGCAAACGAGTAAATATGCATTTATATATTT
TGTCCTCTTCTTCTTTTTCCTCTTTCAATTAGTTCAAACCTTCTCCTCAA
CTTATGGGTTACTATATGACAAATATTTGTATTCTGGGTATATGACCAAT
AGACATGAGAAAACAAAAACTGACGTGCGCCACCTACAAAGCAAAAAAAT
TGTACAGTAAACAGAACGCTGCTGGTCTGTCTAGGACCGTACCTTAAAGC
AAAAAAGGGGGATTTCGTAGAGCAAAATTAAATGTCAAATTCGTTTTTCT
TTGTCAAGTTATACAACTGATTTTTTTTTTTGGACTAACCTTGATTAAGA
AGCTTGCGATGAGGACCAACATTGGTGTTACCAGTGATGGCTGAATTTGC
GTCCGCCATGAAATTGGGACCAATAAGTATGCCTGGAATCAAAGTCGATT
AATGAAGCATTAAAGA
Genomic location of TG288  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D238 marker 238
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)