SGN Marker solcap_snp_sl_48426

SGN-M23803

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73144)
Chromosome
8
Position
40.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69059)
Chromosome
8
Position
33.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65424)
Chromosome
8
Position
48.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60134)
Chromosome
8
Position
54.73 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTATTTGGACTTCCATTTCTTTTTATGTTATGGCGAGGTGTTTATTTTT
  
3' flanking region
GACAGAAGAATAATTCTCCTGAGAAGTTTGAGGATTTAAGGAAAATGGAT
SNP nucleotide
TG
SNPdb format
TGTATTTGGACTTCCATTTCTTTTTATGTTATGGCGAGGTGTTTATTTTT[T/G]
GACAGAAGAATAATTCTCCTGAGAAGTTTGAGGATTTAAGGAAAATGGAT
  
Genomic location of solcap_snp_sl_48426  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23803 marker 23803
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)