SGN Marker solcap_snp_sl_48484

SGN-M23806

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69061)
Chromosome
8
Position
29.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65426)
Chromosome
8
Position
45.41 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60137)
Chromosome
8
Position
54.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCATCAAAAGTATCTCTCCACATACAAACAAAGGCAAATCCATTATAATC
  
3' flanking region
CTCTAAGCAAACAAAACCTATAAATTCACCAGCACAAACATTTCATAGAT
SNP nucleotide
AC
SNPdb format
CCATCAAAAGTATCTCTCCACATACAAACAAAGGCAAATCCATTATAATC[A/C]
CTCTAAGCAAACAAAACCTATAAATTCACCAGCACAAACATTTCATAGAT
  
Genomic location of solcap_snp_sl_48484  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23806 marker 23806
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)