SGN Marker solcap_snp_sl_48550

SGN-M23810

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73148)
Chromosome
8
Position
35.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69064)
Chromosome
8
Position
26.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65429)
Chromosome
8
Position
43.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60141)
Chromosome
8
Position
53.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATTTATATAGTCATTCATAAATTCCCATCGAATCTCCCAAACTCCAAAT
  
3' flanking region
AATCATAAAATTAAACTCACGTTTATTGTGTGAGAGACTCTGGATACCTA
SNP nucleotide
TC
SNPdb format
CATTTATATAGTCATTCATAAATTCCCATCGAATCTCCCAAACTCCAAAT[T/C]
AATCATAAAATTAAACTCACGTTTATTGTGTGAGAGACTCTGGATACCTA
  
Genomic location of solcap_snp_sl_48550  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23810 marker 23810
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)