SGN Marker solcap_snp_sl_48716

SGN-M23831

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73159)
Chromosome
8
Position
29.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69073)
Chromosome
8
Position
21.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60162)
Chromosome
8
Position
51.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTTGATGTTTATTCCCCATTCTCCGTTAGCCCTGATTCTGCTTTCGATG
  
3' flanking region
TTTGACGGCGTTGCAGCGTTACCTGCCATCAAATGGTAACGATGTGATTT
SNP nucleotide
TC
SNPdb format
GGTTGATGTTTATTCCCCATTCTCCGTTAGCCCTGATTCTGCTTTCGATG[T/C]
TTTGACGGCGTTGCAGCGTTACCTGCCATCAAATGGTAACGATGTGATTT
  
Genomic location of solcap_snp_sl_48716  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23831 marker 23831
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)