SGN Marker solcap_snp_sl_48880

SGN-M23852

Synonyms  
SGN-U566706_snp619
SGN-U566706_snp619_solcap_snp_sl_48880
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70388)
Chromosome
5
Position
33.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66919)
Chromosome
5
Position
37.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63401)
Chromosome
5
Position
40.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60183)
Chromosome
5
Position
4.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGAATGTAATTGATTTTCTTTCACCTACAAAATTGCATTGTCAATACT
  
3' flanking region
TTACTCTCTTGCTAGGGCCTAAAGGTAAGCTTAAGCTTCAATCAATCTTG
SNP nucleotide
AG
SNPdb format
ATTGAATGTAATTGATTTTCTTTCACCTACAAAATTGCATTGTCAATACT[A/G]
TTACTCTCTTGCTAGGGCCTAAAGGTAAGCTTAAGCTTCAATCAATCTTG
  
Genomic location of solcap_snp_sl_48880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23852 marker 23852
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)