SGN Marker solcap_snp_sl_48900

SGN-M23859

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73170)
Chromosome
5
Position
29.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69082)
Chromosome
5
Position
33.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65446)
Chromosome
5
Position
37.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60190)
Chromosome
5
Position
3.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTCGCGAGTTTTGCTCAAGGGAACTTGAAGAAGAAGATTTTAAACAACG
  
3' flanking region
TTTGAGTCATACAACTCATCCTCTGAAGTACCTTCGTCTCCCAATGATCC
SNP nucleotide
AC
SNPdb format
ATTCGCGAGTTTTGCTCAAGGGAACTTGAAGAAGAAGATTTTAAACAACG[A/C]
TTTGAGTCATACAACTCATCCTCTGAAGTACCTTCGTCTCCCAATGATCC
  
Genomic location of solcap_snp_sl_48900  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23859 marker 23859
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)